Journal: bioRxiv

Article Title: Δ133p53 and Δ160p53 isoforms of the tumor suppressor protein p53 exert dominant-negative effect primarily by co-aggregation

doi: 10.1101/2024.07.23.604790

Figure Lengend Snippet: (A-D) H1299 cells were transfected with luciferase reporter plasmids driven by p21 (A), MDM2 (B), BAX (C), and PUMA (D) promoters, along with vectors expressing FLp53, Δ133p53, or Δ160p53. To evaluate the influence of the isoforms on FLp53’s transactivation capability, co-expression was performed at ratios of 1:1, 1:5, and 1:10 relative to FLp53. Basal promoter activity was determined by transfecting cells with the empty vector, pcDNA3.1. Relative promoter activity is shown after normalization to the pcDNA3.1-treated sample activity. Data represent mean values ± standard deviation (SD) (n=3). * P < 0.05; ** P < 0.01 (Student’s t-test). (E-H) The transcriptional activity of FLp53 on the p21 (E), MDM2 (F), BAX (G), and PUMA (H) promoters was inhibited by Δ133p53 and Δ160p53. Inhibition curve fitting was performed using the exponential function ExpDec1 in Origin 2018 software.

Article Snippet: Luciferase reporter plasmids, WWP/p21-Luc (Plasmid #16451) , pGL3-MDM2-Luc (Plasmid #32365) , and PUMA Frag1-Luc (Plasmid #16591) were obtained from Addgene.

Techniques: Transfection, Luciferase, Expressing, Activity Assay, Plasmid Preparation, Standard Deviation, Inhibition, Software

Journal: Cell reports

Article Title: Repurposing antiparasitic antimonials to noncovalently rescue temperature-sensitive p53 mutations.

doi: 10.1016/j.celrep.2022.110622

Figure Lengend Snippet: Figure 1. Identification of PAT (A) Identification of TS p53 mutations in human cells. In the dot plot, the y axis shows the fold change of the normalized reads of 815 p53 variants in U937 cells after 7 days of culture at sub-physiological and body temperatures (32C versus 37C), and the x axis shows the frequency of each variant in the IARC p53 database (http://p53.iarc.fr/DownloadDataset.aspx). (B) High-throughput screening of clinical and pre-clinical compounds with the ability to thermostabilize the V272M DBD. Recombinant V272M DBD was mixed with each compound at a molar ratio of 1:20, followed by immediate Tm determination in the DSF assay, without an incubation step. Hits with DTm >1C are indicated with red dots. Details are shown in the STAR Methods. (C) V272M DBD was mixed with the indicated compounds at the indicated Cpd/DBD molar ratios, followed by immediate Tm determination in the DSF assay, without an incubation step. (D) PAb1620 IP assay for the 9 hits from (B). H1299 cells expressing p53-V272M were treated with the 9 hits at the indicated concentrations shown in brackets (mM) overnight. Cells were lysed, followed by IP using an anti-p53 PAb1620 antibody. (E) Luciferase reporter assay of p53-V272M transcriptional activity on the CDKN1A promoter in H1299 cells after 24 h of treatment with the 9 hits at concentrations of 2, 10, or 50 mM. Samples with more than 50% dead cells during treatment were excluded, and such samples were represented by white bars labeled with ‘‘not available’’ (NA). Bar graphs show the normalized relative light units (RLU). Error bars in (C) and (E) represent the means ± SD (n = 3). *p < 0.05. See also Figure S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human: MDA-MB-468 ATCC HTB-132 Human: A431 ATCC CRL-1555 Oligonucleotides PUMA_F: GACCTCAACGCACAGTACGA This paper N/A PUMA_R: GAGATTGTACAGGACCCTCCA This paper N/A CDKN1A_F: CCGAAGTCAGTTCCTTGTGG This paper N/A CDKN1A_R: CATGGGTTCTGACGGACAT This paper N/A MDM2_F: ATCAGGCAGGGGAGAGTGAT This paper N/A MDM2_R: GGTAGAAATCTGTCATGCTGG This paper N/A b-ACTIN_F: ACTTAGTTGCGTTACACCCTTTCT (Chen et al., 2021) N/A b-ACTIN_R: GACTGCTGTCACCTTCACCGT (Chen et al., 2021) N/A Recombinant DNA pGL3-p21-luc (Chen et al., 2021) N/A pGL3-PUMA-luc (Chen et al., 2021) N/A pGL3-MDM2-luc (Chen et al., 2021) N/A MIGR1-human p53, various mutants Addgene N/A pET28a-human p53 DBD, various mutants Novagen N/A Software and algorithms RocheLC480 software version 1.5.0 Roche https://lifescience.roche.com/en_cn/products/ lightcycler14301-480-software-version-15.html FastQC Babraham Institute https://www.bioinformat-ics.babraham.ac.uk/ projects/fastqc/ Cutadapt (Martin, 2011) https://cutadapt.readthedocs.io/en/stable/ STAR (Dobin et al., 2013) http://code.google.com/p/rna-star/ XDS (Kabsch, 2010) http://xds.mpimf-heidelberg.mpg.de/ Phaser (McCoy et al., 2007) http://www.ccp4.ac.uk/ Coot (Emsley and Cowtan, 2004) https://www2.mrc-lmb.cam.ac.uk/personal/ pemsley/coot/ Refmac5 (Vagin et al., 2004) https://www.ucl.ac.uk/ rmhasek/refmac.html MolProbity (Williams et al., 2018) http://molprobity.manchester.ac.uk/ PyMOL software, version 2.1 Molecular Graphics System, Version 1.8 Schrödinger https://pymol.org/2/ CCP4i, version 7.0.024 (Potterton et al., 2003) https://www.ccp4.ac.uk/ GraphPad Prism 6.0 GraphPad Software https://www.graphpad.com/ LigPlot (Wallace et al., 1995) https://www.ebi.ac.uk/thornton-srv/software/ LIGPLOT/ ORFCall GitHub https://github.com/tedsharpe/ORFCall GFOLD V1.1.4 (Feng et al., 2012) https://zhanglab.tongji.edu.cn/softwares/ GFOLD/index.html Biacore 8K evaluation software 3.0.

Techniques: Variant Assay, High Throughput Screening Assay, Recombinant, Incubation, Expressing, Luciferase, Reporter Assay, Activity Assay, Labeling

Journal: Cell reports

Article Title: Repurposing antiparasitic antimonials to noncovalently rescue temperature-sensitive p53 mutations.

doi: 10.1016/j.celrep.2022.110622

Figure Lengend Snippet: Figure 3. Restoration of the tumor-suppressive function of p53 in vitro and in vivo (A–C) PAT treatment upregulated the indicated p53 targets at the mRNA and protein levels. Cells were treated with PAT for 24 or 48 h, followed by mRNA detection by qPCR and protein detection by immunoblotting, respectively. (A) LK-2 cells with endogenous p53-V272M were treated with increasing concentrations of PAT. (B) The indicated cell panels with endogenous mutant p53 were treated with PAT at the indicated concentrations (mM). (C) Isogenic U937 cell lines expressing exogenous mutant p53 were treated with PAT at the indicated concentrations (mM). (D and E) RNA-seq analysis of isogenic U937 cell lines upon PAT treatment. (D) p53-null U937 cells expressing either V272M or R273H were treated with 10 mM PAT for 24 h, followed by RNA-seq analysis. Heatmap of the relative mRNA levels of the reported 116 p53 targets are shown. U937 cells infected with wild-type p53 were used as a positive control. (E) Bar graphs showing the 10 most highly enriched TRRUST transcription factors or MSigDB Hallmark pathways for the genes significantly upregulated by PAT in U937 cells expressing p53-V272M (fold change R2, generalized fold change [GFOLD] R0.5). The length of each bar represents the significance level of the en- riched items.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human: MDA-MB-468 ATCC HTB-132 Human: A431 ATCC CRL-1555 Oligonucleotides PUMA_F: GACCTCAACGCACAGTACGA This paper N/A PUMA_R: GAGATTGTACAGGACCCTCCA This paper N/A CDKN1A_F: CCGAAGTCAGTTCCTTGTGG This paper N/A CDKN1A_R: CATGGGTTCTGACGGACAT This paper N/A MDM2_F: ATCAGGCAGGGGAGAGTGAT This paper N/A MDM2_R: GGTAGAAATCTGTCATGCTGG This paper N/A b-ACTIN_F: ACTTAGTTGCGTTACACCCTTTCT (Chen et al., 2021) N/A b-ACTIN_R: GACTGCTGTCACCTTCACCGT (Chen et al., 2021) N/A Recombinant DNA pGL3-p21-luc (Chen et al., 2021) N/A pGL3-PUMA-luc (Chen et al., 2021) N/A pGL3-MDM2-luc (Chen et al., 2021) N/A MIGR1-human p53, various mutants Addgene N/A pET28a-human p53 DBD, various mutants Novagen N/A Software and algorithms RocheLC480 software version 1.5.0 Roche https://lifescience.roche.com/en_cn/products/ lightcycler14301-480-software-version-15.html FastQC Babraham Institute https://www.bioinformat-ics.babraham.ac.uk/ projects/fastqc/ Cutadapt (Martin, 2011) https://cutadapt.readthedocs.io/en/stable/ STAR (Dobin et al., 2013) http://code.google.com/p/rna-star/ XDS (Kabsch, 2010) http://xds.mpimf-heidelberg.mpg.de/ Phaser (McCoy et al., 2007) http://www.ccp4.ac.uk/ Coot (Emsley and Cowtan, 2004) https://www2.mrc-lmb.cam.ac.uk/personal/ pemsley/coot/ Refmac5 (Vagin et al., 2004) https://www.ucl.ac.uk/ rmhasek/refmac.html MolProbity (Williams et al., 2018) http://molprobity.manchester.ac.uk/ PyMOL software, version 2.1 Molecular Graphics System, Version 1.8 Schrödinger https://pymol.org/2/ CCP4i, version 7.0.024 (Potterton et al., 2003) https://www.ccp4.ac.uk/ GraphPad Prism 6.0 GraphPad Software https://www.graphpad.com/ LigPlot (Wallace et al., 1995) https://www.ebi.ac.uk/thornton-srv/software/ LIGPLOT/ ORFCall GitHub https://github.com/tedsharpe/ORFCall GFOLD V1.1.4 (Feng et al., 2012) https://zhanglab.tongji.edu.cn/softwares/ GFOLD/index.html Biacore 8K evaluation software 3.0.

Techniques: In Vitro, In Vivo, Western Blot, Mutagenesis, Expressing, RNA Sequencing, Infection, Positive Control

Journal: Cell reports

Article Title: Repurposing antiparasitic antimonials to noncovalently rescue temperature-sensitive p53 mutations.

doi: 10.1016/j.celrep.2022.110622

Figure Lengend Snippet: Figure 4. PAT effectively rescued p53-V272M in primary leukemia cells at clinically applicable doses of antimony (A) PBMCs from an AML patient were cultured in vitro and treated with 5 mM PAT or mock treated with PBS, followed by scRNA-seq. In the shown uniform mani- fold approximation and projection (UMAP) of the scRNA-seq data, each dot represents a cell, and annotated cell types are distinguished by colors (Cancer, can- cer cells; DC, dendritic cells; Mono, monocytes; T/NK, T cells or NK cells; B, B cells). Dot plot of marker genes for each cluster is shown on the right. (B) Volcano plot of DEGs (p % 0.01, fold change R2.0 or %0.5) that are upregulated (red) or downregulated (blue) in cancer cells upon PAT treatment. The DEGs annotated in the p53 pathway are labeled, with asterisks showing those also annotated in the apoptosis pathway. The right panel shows the top 5 enriched MSigDB Hallmark pathway terms associated with the DEGs. (C) UMAP manifold of cancer cells colored according to treatment (top panel), and the averaged p53 target gene expression levels (bottom panel). Of the 116 well- established p53 targets, 107 were detectable in the scRNA-seq dataset and were used in the bottom panel. (D) UMAP manifold of cancer cells in the control (PBS) and PAT-treated samples. The lower bar graphs show the fraction of cells in each cluster in each sample. (E) Heatmap depicting the relative expression of well-established p53 targets in each of the C2–C4 clusters. A total of 107 detectable p53 targets are shown. (F) GO-Biological Process (BP) enrichment analysis of the specifically upregulated p53 targets in the C2, C3, and C4 clusters. The top 3 GO-BP terms are shown. DDR, DNA damage response. (G) Pseudotime analysis illustrating the transitional relationship between different clusters of PAT-treated and untreated cancer cells. See also Figure S4.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human: MDA-MB-468 ATCC HTB-132 Human: A431 ATCC CRL-1555 Oligonucleotides PUMA_F: GACCTCAACGCACAGTACGA This paper N/A PUMA_R: GAGATTGTACAGGACCCTCCA This paper N/A CDKN1A_F: CCGAAGTCAGTTCCTTGTGG This paper N/A CDKN1A_R: CATGGGTTCTGACGGACAT This paper N/A MDM2_F: ATCAGGCAGGGGAGAGTGAT This paper N/A MDM2_R: GGTAGAAATCTGTCATGCTGG This paper N/A b-ACTIN_F: ACTTAGTTGCGTTACACCCTTTCT (Chen et al., 2021) N/A b-ACTIN_R: GACTGCTGTCACCTTCACCGT (Chen et al., 2021) N/A Recombinant DNA pGL3-p21-luc (Chen et al., 2021) N/A pGL3-PUMA-luc (Chen et al., 2021) N/A pGL3-MDM2-luc (Chen et al., 2021) N/A MIGR1-human p53, various mutants Addgene N/A pET28a-human p53 DBD, various mutants Novagen N/A Software and algorithms RocheLC480 software version 1.5.0 Roche https://lifescience.roche.com/en_cn/products/ lightcycler14301-480-software-version-15.html FastQC Babraham Institute https://www.bioinformat-ics.babraham.ac.uk/ projects/fastqc/ Cutadapt (Martin, 2011) https://cutadapt.readthedocs.io/en/stable/ STAR (Dobin et al., 2013) http://code.google.com/p/rna-star/ XDS (Kabsch, 2010) http://xds.mpimf-heidelberg.mpg.de/ Phaser (McCoy et al., 2007) http://www.ccp4.ac.uk/ Coot (Emsley and Cowtan, 2004) https://www2.mrc-lmb.cam.ac.uk/personal/ pemsley/coot/ Refmac5 (Vagin et al., 2004) https://www.ucl.ac.uk/ rmhasek/refmac.html MolProbity (Williams et al., 2018) http://molprobity.manchester.ac.uk/ PyMOL software, version 2.1 Molecular Graphics System, Version 1.8 Schrödinger https://pymol.org/2/ CCP4i, version 7.0.024 (Potterton et al., 2003) https://www.ccp4.ac.uk/ GraphPad Prism 6.0 GraphPad Software https://www.graphpad.com/ LigPlot (Wallace et al., 1995) https://www.ebi.ac.uk/thornton-srv/software/ LIGPLOT/ ORFCall GitHub https://github.com/tedsharpe/ORFCall GFOLD V1.1.4 (Feng et al., 2012) https://zhanglab.tongji.edu.cn/softwares/ GFOLD/index.html Biacore 8K evaluation software 3.0.

Techniques: Cell Culture, In Vitro, Marker, Labeling, Targeted Gene Expression, Control, Expressing

Journal: Cell reports

Article Title: Repurposing antiparasitic antimonials to noncovalently rescue temperature-sensitive p53 mutations.

doi: 10.1016/j.celrep.2022.110622

Figure Lengend Snippet: Figure 5. Defining PAT-treatable mutations (A) Heatmap showing the fold-change profile of the normalized reads of 815 p53 variants in U937 cells after 7 days of culture at sub-physiological temperature (the first two lanes, derived from Figure S1B) and in U937 cells upon PAT treatment for 7 days (lanes 3–8, the fold change of each variant was calculated relative to the mean reads of the two untreated replicates). (B) Dot plot showing the fold changes of normalized reads of 815 p53 variants for the indicated comparisons. The coefficient (R) and p value from Pearson correlation analysis are shown. The 85 variants significantly inhibited by PAT in (A) are indicated with red dots. (C) Luciferase reporter assay of the transcriptional activity of the indicated 65 p53 mutants on the PUMA promoter in H1299 cells upon treatment with 10 mM PAT for 24 h. Bar graphs showing the normalized RLU. (D) Cartoon representation of Sb-bound V272M DBD (chain A). The cavity surrounding Sb-binding pocket is shown as pink near-transparent surface. Residues corresponding to the top 10 PAT-rescued mutants in (C) are shown as pink (for those in the cavity) or green (for those outside the cavity) sticks. Sb and Zn atoms are shown as red and black spheres, respectively. (E) TS phenotype of the top 10 PAT-rescued mutants in (C). Luciferase reporter assay of the transcriptional activity of the indicated 10 mutants on the PUMA promoter in H1299 cells after culture at sub-physiological and body temperatures (32C versus 37C) for 36 h. Bar graphs showing the fold change of RLU. (F) PAT upregulated the indicated p53 targets at the mRNA and protein levels. Isogenic U937 cell lines expressing exogenous mutant p53 were treated with PAT for 24 or 48 h, followed by mRNA detection by qPCR and protein detection by immunoblotting, respectively. Error bars in (C), (E), and (F) represent the means ± SD (n = 3). *p < 0.05. See also Figure S5.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human: MDA-MB-468 ATCC HTB-132 Human: A431 ATCC CRL-1555 Oligonucleotides PUMA_F: GACCTCAACGCACAGTACGA This paper N/A PUMA_R: GAGATTGTACAGGACCCTCCA This paper N/A CDKN1A_F: CCGAAGTCAGTTCCTTGTGG This paper N/A CDKN1A_R: CATGGGTTCTGACGGACAT This paper N/A MDM2_F: ATCAGGCAGGGGAGAGTGAT This paper N/A MDM2_R: GGTAGAAATCTGTCATGCTGG This paper N/A b-ACTIN_F: ACTTAGTTGCGTTACACCCTTTCT (Chen et al., 2021) N/A b-ACTIN_R: GACTGCTGTCACCTTCACCGT (Chen et al., 2021) N/A Recombinant DNA pGL3-p21-luc (Chen et al., 2021) N/A pGL3-PUMA-luc (Chen et al., 2021) N/A pGL3-MDM2-luc (Chen et al., 2021) N/A MIGR1-human p53, various mutants Addgene N/A pET28a-human p53 DBD, various mutants Novagen N/A Software and algorithms RocheLC480 software version 1.5.0 Roche https://lifescience.roche.com/en_cn/products/ lightcycler14301-480-software-version-15.html FastQC Babraham Institute https://www.bioinformat-ics.babraham.ac.uk/ projects/fastqc/ Cutadapt (Martin, 2011) https://cutadapt.readthedocs.io/en/stable/ STAR (Dobin et al., 2013) http://code.google.com/p/rna-star/ XDS (Kabsch, 2010) http://xds.mpimf-heidelberg.mpg.de/ Phaser (McCoy et al., 2007) http://www.ccp4.ac.uk/ Coot (Emsley and Cowtan, 2004) https://www2.mrc-lmb.cam.ac.uk/personal/ pemsley/coot/ Refmac5 (Vagin et al., 2004) https://www.ucl.ac.uk/ rmhasek/refmac.html MolProbity (Williams et al., 2018) http://molprobity.manchester.ac.uk/ PyMOL software, version 2.1 Molecular Graphics System, Version 1.8 Schrödinger https://pymol.org/2/ CCP4i, version 7.0.024 (Potterton et al., 2003) https://www.ccp4.ac.uk/ GraphPad Prism 6.0 GraphPad Software https://www.graphpad.com/ LigPlot (Wallace et al., 1995) https://www.ebi.ac.uk/thornton-srv/software/ LIGPLOT/ ORFCall GitHub https://github.com/tedsharpe/ORFCall GFOLD V1.1.4 (Feng et al., 2012) https://zhanglab.tongji.edu.cn/softwares/ GFOLD/index.html Biacore 8K evaluation software 3.0.

Techniques: Derivative Assay, Variant Assay, Luciferase, Reporter Assay, Activity Assay, Binding Assay, Expressing, Mutagenesis, Western Blot

Journal: Cell reports

Article Title: Repurposing antiparasitic antimonials to noncovalently rescue temperature-sensitive p53 mutations.

doi: 10.1016/j.celrep.2022.110622

Figure Lengend Snippet: Figure 6. Workflow and clinical relevance of the current study (A) Workflow of PAT identification. From left to right: a rational screen system for noncovalent mutant p53 rescue compounds (red panel), validation of hits for their effectiveness in biochemical and cell assays (yellow panel), evaluation of robustness of PAT as a targeted compound using the three go-to criteria (blue panel), and functional validations in vitro and in vivo, respectively (green panel). (B) Information of the p53 function-regulating agents that have entered into clinical trials. For simplification, the p53 status were divided into four classes: wild type, structural mutations, and DNA contacting (DNA-conct.) mutations, and others. The red rectangles and red question marks summarize scopes of the treatable patients of the indicated agents. The top panel summarizes the information for p53-targeted agents, and the bottom panel summarizes the information for p53-regulator-targeted agents. See also Figure S6.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Human: MDA-MB-468 ATCC HTB-132 Human: A431 ATCC CRL-1555 Oligonucleotides PUMA_F: GACCTCAACGCACAGTACGA This paper N/A PUMA_R: GAGATTGTACAGGACCCTCCA This paper N/A CDKN1A_F: CCGAAGTCAGTTCCTTGTGG This paper N/A CDKN1A_R: CATGGGTTCTGACGGACAT This paper N/A MDM2_F: ATCAGGCAGGGGAGAGTGAT This paper N/A MDM2_R: GGTAGAAATCTGTCATGCTGG This paper N/A b-ACTIN_F: ACTTAGTTGCGTTACACCCTTTCT (Chen et al., 2021) N/A b-ACTIN_R: GACTGCTGTCACCTTCACCGT (Chen et al., 2021) N/A Recombinant DNA pGL3-p21-luc (Chen et al., 2021) N/A pGL3-PUMA-luc (Chen et al., 2021) N/A pGL3-MDM2-luc (Chen et al., 2021) N/A MIGR1-human p53, various mutants Addgene N/A pET28a-human p53 DBD, various mutants Novagen N/A Software and algorithms RocheLC480 software version 1.5.0 Roche https://lifescience.roche.com/en_cn/products/ lightcycler14301-480-software-version-15.html FastQC Babraham Institute https://www.bioinformat-ics.babraham.ac.uk/ projects/fastqc/ Cutadapt (Martin, 2011) https://cutadapt.readthedocs.io/en/stable/ STAR (Dobin et al., 2013) http://code.google.com/p/rna-star/ XDS (Kabsch, 2010) http://xds.mpimf-heidelberg.mpg.de/ Phaser (McCoy et al., 2007) http://www.ccp4.ac.uk/ Coot (Emsley and Cowtan, 2004) https://www2.mrc-lmb.cam.ac.uk/personal/ pemsley/coot/ Refmac5 (Vagin et al., 2004) https://www.ucl.ac.uk/ rmhasek/refmac.html MolProbity (Williams et al., 2018) http://molprobity.manchester.ac.uk/ PyMOL software, version 2.1 Molecular Graphics System, Version 1.8 Schrödinger https://pymol.org/2/ CCP4i, version 7.0.024 (Potterton et al., 2003) https://www.ccp4.ac.uk/ GraphPad Prism 6.0 GraphPad Software https://www.graphpad.com/ LigPlot (Wallace et al., 1995) https://www.ebi.ac.uk/thornton-srv/software/ LIGPLOT/ ORFCall GitHub https://github.com/tedsharpe/ORFCall GFOLD V1.1.4 (Feng et al., 2012) https://zhanglab.tongji.edu.cn/softwares/ GFOLD/index.html Biacore 8K evaluation software 3.0.

Techniques: Mutagenesis, Biomarker Discovery, Functional Assay, In Vitro, In Vivo, Clinical Proteomics